Benavides1 project protocol

G protein-coupled receptor 84 (Gpr84) loss-of-function allele assessed in 58 inbred strains of mice   (2013)

Benavides F, Guenet J
With: Perez CJ, Dumas A, Vallières L




Benavides1_protocol

Project protocol - Contents

Workflow and sampling

Step
Procedure performed
Data collected
1
 PCR of Gpr84 exon 2
-
2
 Purification of PCR products
-
3
 Sequencing of PCR products
Gpr84 exon 2 sequence

Equipment and supplies

  • PCR System
  • QIAquick PCR Purification columns (Qiagen, Valencia CA)
  • ABI 3130XL DNA sequencer (Perkin Elmer)

Reagents and solutions

  • Gpr84 exon 2 primers (sequences below)
  • AmpliTaq polymerase
  • MgCl2
  • Deoxyribonucleotides
  • PCR buffer 10X (Applied Biosystems, Foster City CA)
  • ABI-PRISMTM Dye Terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer)

Procedure: PCR and sequencing

Gpr84 exon 2 primers. FOR:GCAAGTTCTCATACCATCTCCC; REV:AGCCCAAGCACAAAGTAGATG

    1. Reactions are prepared to contain genomic DNA (50ng), 5 pmol of each primer, 1.5 mmol/L MgCl2, 0.2 mmol/L of each deoxyribonucleotide, 2 µL PCR buffer, and 1.5 units of AmpliTaq DNA polymerase.
    2. Samples are subjected to 1 cycle of denaturation (95°C, 60 s), followed by 35 cycles of denaturation (95°C, 35 s), annealing (58°C, 45 s), and extension (68°C, 45 s).
    3. PCR products are purified with QIAquick PCR Purification columns.
    4. Purified PCR products are sequenced using the ABI-PRISMTM Dye Terminator Cycle Sequencing Ready Reaction Kit.
    5. Samples are run on an ABI DNA sequencer.

Definitions and calculations

  • Gpr84 = G protein-coupled receptor 84
  • Gpr84 allele designation:
    • 0 = 2bp deletion (framshift, premature stop codon)
    • 1 = no deletion (full length protein)

Data collected by investigator

  • Gpr84 exon 2 sequence